ID: 1051272092_1051272099

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1051272092 1051272099
Species Human (GRCh38) Human (GRCh38)
Location 9:15365532-15365554 9:15365557-15365579
Sequence CCAGCCAGCTTCACCTCAGACAC GCACTTTGGGAGGCCGATGCAGG
Strand - +
Off-target summary No data {0: 366, 1: 88627, 2: 228377, 3: 238400, 4: 154794}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!