ID: 1051352969_1051352972

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1051352969 1051352972
Species Human (GRCh38) Human (GRCh38)
Location 9:16215586-16215608 9:16215609-16215631
Sequence CCGCACAAAACAAATCAAAATAT GGCCCCAGGAGACAACTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 158, 4: 1677} {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!