ID: 1051379720_1051379726

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1051379720 1051379726
Species Human (GRCh38) Human (GRCh38)
Location 9:16443766-16443788 9:16443810-16443832
Sequence CCAAGCATATGAAATTCTGGAAA AAGTGGATTAGTAGTTGCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!