ID: 1051629237_1051629256

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1051629237 1051629256
Species Human (GRCh38) Human (GRCh38)
Location 9:19127336-19127358 9:19127364-19127386
Sequence CCCCGGGGAGCCCCCCACCCCAA CGCCGCTGGGGGCCCGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 29, 4: 347} {0: 1, 1: 0, 2: 1, 3: 23, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!