ID: 1051820988_1051820994

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1051820988 1051820994
Species Human (GRCh38) Human (GRCh38)
Location 9:21168069-21168091 9:21168119-21168141
Sequence CCTCTGCCCTATAGATACTGAGT CAAATCAGCTATTTAGTAAGTGG
Strand - +
Off-target summary No data {0: 5, 1: 1, 2: 1, 3: 21, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!