ID: 1051822276_1051822282

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1051822276 1051822282
Species Human (GRCh38) Human (GRCh38)
Location 9:21181739-21181761 9:21181755-21181777
Sequence CCACCCGTCACATCACCAGGCAG CAGGCAGGGAACCCCTGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 2, 3: 10, 4: 151} {0: 3, 1: 3, 2: 26, 3: 68, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!