ID: 1051822989_1051822998

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1051822989 1051822998
Species Human (GRCh38) Human (GRCh38)
Location 9:21190870-21190892 9:21190915-21190937
Sequence CCTGCCCTAAGCAAGACTCCAGG CAGTGTGGAGCTGGTCCAGGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 19, 4: 226} {0: 3, 1: 2, 2: 1, 3: 33, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!