ID: 1051840827_1051840847

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1051840827 1051840847
Species Human (GRCh38) Human (GRCh38)
Location 9:21396183-21396205 9:21396234-21396256
Sequence CCTGCGGACCCTAATCCCCAAGC GCGCGGGTCTCCTTGAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83} {0: 1, 1: 0, 2: 0, 3: 2, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!