ID: 1051876889_1051876911

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1051876889 1051876911
Species Human (GRCh38) Human (GRCh38)
Location 9:21802834-21802856 9:21802884-21802906
Sequence CCCCCGCGCCGGGGGACCGCGCC GTCCCTTGCCGCCGCGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 211} {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!