ID: 1051889884_1051889895

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1051889884 1051889895
Species Human (GRCh38) Human (GRCh38)
Location 9:21930829-21930851 9:21930881-21930903
Sequence CCTCCAGCTTACAAGAACAAGCC CTGGAAATGGGATCTTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108} {0: 1, 1: 0, 2: 1, 3: 19, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!