ID: 1051890169_1051890174

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1051890169 1051890174
Species Human (GRCh38) Human (GRCh38)
Location 9:21933147-21933169 9:21933190-21933212
Sequence CCCTATTTATTCATGGGCACCAT TTTTTTCTTTTGAAGCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 149} {0: 1, 1: 0, 2: 7, 3: 139, 4: 1049}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!