ID: 1052057850_1052057860

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1052057850 1052057860
Species Human (GRCh38) Human (GRCh38)
Location 9:23923737-23923759 9:23923786-23923808
Sequence CCTTTGAAGATGTCTTTGATTAT GAGGCTTATCATTACTAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!