ID: 1052192668_1052192686

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1052192668 1052192686
Species Human (GRCh38) Human (GRCh38)
Location 9:25677667-25677689 9:25677714-25677736
Sequence CCGGCTGCGGCCTCGGCTACAGC CGGGAGCGGAGGCCGGAGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 224} {0: 1, 1: 0, 2: 0, 3: 27, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!