ID: 1052362191_1052362197

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1052362191 1052362197
Species Human (GRCh38) Human (GRCh38)
Location 9:27573365-27573387 9:27573389-27573411
Sequence CCCGCGCCTCTTCCCGGCAGCCG ACCCCAAACAGCCACCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 231} {0: 1, 1: 0, 2: 2, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!