ID: 1052781464_1052781469

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1052781464 1052781469
Species Human (GRCh38) Human (GRCh38)
Location 9:32784627-32784649 9:32784652-32784674
Sequence CCTCGTCCAGAATGGGCATCAGG GAGACGTCCAGATACCTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 90} {0: 1, 1: 10, 2: 1, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!