ID: 1052917232_1052917236

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1052917232 1052917236
Species Human (GRCh38) Human (GRCh38)
Location 9:33932754-33932776 9:33932770-33932792
Sequence CCATCCTCATTCCTTATCCCCAC TCCCCACAGAGCCCAGTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 642} {0: 1, 1: 1, 2: 0, 3: 17, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!