ID: 1052975306_1052975315

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1052975306 1052975315
Species Human (GRCh38) Human (GRCh38)
Location 9:34405832-34405854 9:34405856-34405878
Sequence CCCACATCTCCCTCACCCCCCAG CACACTCACCCAGCTTCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 87, 4: 787} {0: 1, 1: 0, 2: 5, 3: 20, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!