ID: 1053006879_1053006892

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1053006879 1053006892
Species Human (GRCh38) Human (GRCh38)
Location 9:34610845-34610867 9:34610876-34610898
Sequence CCACAGCTGGAGCTGGGCATGGA CAGGGGGTGCTCCTGGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 441} {0: 1, 1: 0, 2: 5, 3: 44, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!