ID: 1053023115_1053023120

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1053023115 1053023120
Species Human (GRCh38) Human (GRCh38)
Location 9:34709313-34709335 9:34709338-34709360
Sequence CCTCCTTCTTGCATCTTGGGTTC GCTTCAAGCGCTGGTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 191} {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!