ID: 1053071208_1053071212

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1053071208 1053071212
Species Human (GRCh38) Human (GRCh38)
Location 9:35103098-35103120 9:35103115-35103137
Sequence CCACCGCCGCAGCGACCTCCGGA TCCGGAACCAACGAGACGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209} {0: 1, 1: 0, 2: 0, 3: 0, 4: 5}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!