ID: 1053147807_1053147817

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1053147807 1053147817
Species Human (GRCh38) Human (GRCh38)
Location 9:35723834-35723856 9:35723864-35723886
Sequence CCTGGTACCTCGGAAGAAGAAAT GGCAGGCTTGGAATGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125} {0: 1, 1: 0, 2: 1, 3: 16, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!