ID: 1053161504_1053161506

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1053161504 1053161506
Species Human (GRCh38) Human (GRCh38)
Location 9:35816615-35816637 9:35816639-35816661
Sequence CCTAACTCTATTGTTGACTATTA TTGAATTAGTTTTAGGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173} {0: 1, 1: 0, 2: 1, 3: 22, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!