ID: 1053168942_1053168956

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1053168942 1053168956
Species Human (GRCh38) Human (GRCh38)
Location 9:35864768-35864790 9:35864817-35864839
Sequence CCTCTCACCTACTGGCCATGGCC GGTGAGGGGAGCTGTGGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 188} {0: 1, 1: 0, 2: 2, 3: 33, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!