ID: 1053203814_1053203817

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1053203814 1053203817
Species Human (GRCh38) Human (GRCh38)
Location 9:36170254-36170276 9:36170267-36170289
Sequence CCCTGATTGAGAGTGTCCTGATG TGTCCTGATGGACCGCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 510, 4: 7369} {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!