ID: 1053230162_1053230182

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1053230162 1053230182
Species Human (GRCh38) Human (GRCh38)
Location 9:36401120-36401142 9:36401173-36401195
Sequence CCACCGGAGCGCTCCTCCCTTTT CCTTTGTTTCCACCCCGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80} {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!