ID: 1053283923_1053283927

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1053283923 1053283927
Species Human (GRCh38) Human (GRCh38)
Location 9:36838564-36838586 9:36838577-36838599
Sequence CCAAGCTGGGCCTCAGTTTCCCA CAGTTTCCCACAAGGGAAGTTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 47, 3: 524, 4: 2183} {0: 1, 1: 0, 2: 1, 3: 27, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!