ID: 1053496015_1053496022

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1053496015 1053496022
Species Human (GRCh38) Human (GRCh38)
Location 9:38548535-38548557 9:38548570-38548592
Sequence CCAAGCTGCATCTGTGCATTTTC AGCTGGAGCTGCAGGGACGCAGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 1, 3: 24, 4: 362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!