ID: 1053551629_1053551633

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1053551629 1053551633
Species Human (GRCh38) Human (GRCh38)
Location 9:39085823-39085845 9:39085868-39085890
Sequence CCTATTAGATGTCCCATGAGAAG TTTTAATGATAAGGAAGCAAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 192} {0: 3, 1: 0, 2: 5, 3: 101, 4: 963}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!