ID: 1053559728_1053559730

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1053559728 1053559730
Species Human (GRCh38) Human (GRCh38)
Location 9:39178243-39178265 9:39178279-39178301
Sequence CCATTGCTCTGCATGGCTTTAAA ACGTCTCTTATTGGTTTTAAAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 28, 4: 325} {0: 2, 1: 2, 2: 0, 3: 5, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!