ID: 1053576143_1053576153

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1053576143 1053576153
Species Human (GRCh38) Human (GRCh38)
Location 9:39358395-39358417 9:39358434-39358456
Sequence CCCTGATCCTCTGGCCTGCTCTC CTTCACTGCTCCTCCCCTGCGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 19, 4: 331} {0: 5, 1: 4, 2: 3, 3: 33, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!