ID: 1053752817_1053752825

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1053752817 1053752825
Species Human (GRCh38) Human (GRCh38)
Location 9:41273642-41273664 9:41273670-41273692
Sequence CCAGCCTGAGGGCCCCCAGGCTG CCCGCCCAGTCCTCCACCTGAGG
Strand - +
Off-target summary {0: 4, 1: 8, 2: 10, 3: 61, 4: 526} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!