ID: 1053753767_1053753775

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1053753767 1053753775
Species Human (GRCh38) Human (GRCh38)
Location 9:41281115-41281137 9:41281149-41281171
Sequence CCCTTCCCAGCACTTGTCCAGAG CTCAGCACAGCTCAGACCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 3, 3: 33, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!