ID: 1053762818_1053762826

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1053762818 1053762826
Species Human (GRCh38) Human (GRCh38)
Location 9:41357787-41357809 9:41357822-41357844
Sequence CCACAAACTTCAAATTCAACTCA CCGAGTTGGGGTACCCCTAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!