ID: 1053934617_1053934628

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1053934617 1053934628
Species Human (GRCh38) Human (GRCh38)
Location 9:43138646-43138668 9:43138662-43138684
Sequence CCCTGGCCCCTGTGCCCTTTCTG CTTTCTGGGCAGAGGGTGACAGG
Strand - +
Off-target summary No data {0: 9, 1: 0, 2: 3, 3: 24, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!