ID: 1054119114_1054119127

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1054119114 1054119127
Species Human (GRCh38) Human (GRCh38)
Location 9:61192705-61192727 9:61192755-61192777
Sequence CCACCACACACCCCTGATCCTCT CTTCACTGCTCCTCCCCTGCGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 4, 3: 46, 4: 415} {0: 5, 1: 4, 2: 3, 3: 33, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!