ID: 1054739312_1054739314

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1054739312 1054739314
Species Human (GRCh38) Human (GRCh38)
Location 9:68788684-68788706 9:68788702-68788724
Sequence CCTTTGTCGTGGAGTCAGGCTCA GCTCACGTTTAGGACCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 0, 2: 0, 3: 4, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!