ID: 1055295357_1055295364

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1055295357 1055295364
Species Human (GRCh38) Human (GRCh38)
Location 9:74827632-74827654 9:74827684-74827706
Sequence CCATGTGGGAAGGGGGGTGGCTG ACTAGGAGAGTGAGCTCTGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 43, 4: 404} {0: 1, 1: 0, 2: 2, 3: 11, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!