ID: 1055454342_1055454351

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1055454342 1055454351
Species Human (GRCh38) Human (GRCh38)
Location 9:76459140-76459162 9:76459156-76459178
Sequence CCTAGAAAGGCGGGGCCTCTGGG CTCTGGGGGCGGCCCCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 205} {0: 1, 1: 0, 2: 1, 3: 39, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!