ID: 1055553798_1055553805

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1055553798 1055553805
Species Human (GRCh38) Human (GRCh38)
Location 9:77455461-77455483 9:77455488-77455510
Sequence CCTGCCCACACCCAAAGGGGAAG TATGCAGGACGTGTACACCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 23, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!