ID: 1055638912_1055638914

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1055638912 1055638914
Species Human (GRCh38) Human (GRCh38)
Location 9:78304222-78304244 9:78304241-78304263
Sequence CCCATCTTCTGGCTCTGCTTTCT TTCTTATGTGTTCTCTTCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 67, 4: 574} {0: 1, 1: 1, 2: 1, 3: 21, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!