ID: 1055979067_1055979072

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1055979067 1055979072
Species Human (GRCh38) Human (GRCh38)
Location 9:81983733-81983755 9:81983762-81983784
Sequence CCTCCCACAGGCTGCTTAAAATG TAAGAGCTTATTACAAGGCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!