ID: 1055993433_1055993437

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1055993433 1055993437
Species Human (GRCh38) Human (GRCh38)
Location 9:82131605-82131627 9:82131647-82131669
Sequence CCAGGCTCCAGCTATGGCTACAA AAAAATAAAGTGAATTAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 19, 2: 17, 3: 31, 4: 171} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!