ID: 1056094903_1056094915

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1056094903 1056094915
Species Human (GRCh38) Human (GRCh38)
Location 9:83242951-83242973 9:83243001-83243023
Sequence CCACCCCAGTTCCCAGTAGATAA AAGCAGCTTTATTAATGGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!