ID: 1056163542_1056163551

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1056163542 1056163551
Species Human (GRCh38) Human (GRCh38)
Location 9:83921256-83921278 9:83921275-83921297
Sequence CCAACGGCCGGCTGGGGGCGCGG GCGGGAGCGGCGGGCGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 216} {0: 2, 1: 13, 2: 25, 3: 229, 4: 1415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!