ID: 1056405053_1056405060

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1056405053 1056405060
Species Human (GRCh38) Human (GRCh38)
Location 9:86265637-86265659 9:86265681-86265703
Sequence CCACCATATTACTACCAGCAGTC TAGGAGTCACCGATCTGGTTGGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 1, 3: 7, 4: 75} {0: 1, 1: 2, 2: 3, 3: 6, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!