ID: 1056586786_1056586791

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1056586786 1056586791
Species Human (GRCh38) Human (GRCh38)
Location 9:87932439-87932461 9:87932462-87932484
Sequence CCCACTGACTAGGCTTCCAATGA CTAGGTCACCAGGTCCCCATTGG
Strand - +
Off-target summary {0: 5, 1: 12, 2: 3, 3: 7, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!