ID: 1056902558_1056902564

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1056902558 1056902564
Species Human (GRCh38) Human (GRCh38)
Location 9:90613410-90613432 9:90613427-90613449
Sequence CCAAGGCCTCCGCCTCGCTGCTC CTGCTCTGCACCTCGCGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 301} {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!