ID: 1057054047_1057054057

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1057054047 1057054057
Species Human (GRCh38) Human (GRCh38)
Location 9:91948570-91948592 9:91948607-91948629
Sequence CCCAGGAAAGACTGTGCAGCCTT CTTGGGCCGGCTAGGGCGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!