ID: 1057128563_1057128573

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1057128563 1057128573
Species Human (GRCh38) Human (GRCh38)
Location 9:92637967-92637989 9:92637992-92638014
Sequence CCCCACCGCCTACCTGGGGAAGG GGGCCCTACCTTGGCAGCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 227} {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!