ID: 1057162256_1057162266

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1057162256 1057162266
Species Human (GRCh38) Human (GRCh38)
Location 9:92896798-92896820 9:92896833-92896855
Sequence CCCACTAATAAGGCCACCACTGA TGACTAGGCTTCCAATGACTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!